to top page


TOP > 2013-02-01 >Ascomycota >2150

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
21502013-02-01AscomycotaCf. Ramichloridium sp.GU214688
99
12
264
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAGGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGGTTTAACCGCCCGACCTCCAACCCTTTGTGAATCGTACTCGTTGCTTCGGGGGCGACCCTGCCGTCCGCGGCTGAGCGCCCCCGGGGGTCAATCAAACACTGCATTCTCTGCGTCGGAGTATTAGTAAATCTAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG