to top page


TOP > 2012-11-01 >Ascomycota >2010

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
20102012-11-01AscomycotaUncultured ChloridiumJX317423
99
2
274
-

Sequence

CTTGGTCATTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGGACTCGCAAGACTCCTACAACCCTGTGAACCTACTATACGAACGTTGCTTCGGCGGGTGCGCCCCGGGGATTCGTTCCCGCGGCGCGTCAGCCCGCCGGCAGCCTACAAATTCTGTTTCTTTGCGTTGGCATCTCGAGAAAAACCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG