to top page


TOP > 2012-11-01 >Ascomycota >2009

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
20092012-11-01AscomycotaUncultured ascomyceteAM902005
99
4
277
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTGACCCCCGGCTCCGGCCGGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTTTCACGGGCGGGGGCCCCGGGTGGACACATCAAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATTAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG