to top page


TOP > 2012-11-01 >Ascomycota >2008

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
20082012-11-01AscomycotaPleosporales sp.HE579353
90
1
303
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCCTTTTATCAGGGAGTTTGCTGCCAGCGCGTTTGGGCGCTTCGCTCAGCGCATTGGCTTCAACTCTTTCTGATTCTACCCATGTTTTTTGCGTACTACTTGTTTCCTTGGTGGGCTTGCCTGCCGATAGGACAAAACAAAAACCTCTTGTAATTGCAGTCAGCGTACAGTAACAATGTAATAAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC