to top page


TOP > 2012-11-01 >Ascomycota >2006

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
20062012-11-01AscomycotaPenicillium sp.HM992524
99
15
296
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGTGGCCCAACCTCCCACCCTTGTCTCTATACACCCGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGTTCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAACTTGTCAAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAG