to top page


TOP > 2012-11-01 >Ascomycota >2004

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
20042012-11-01AscomycotaPenicillium sp.GU565132
100
1
290
-

Sequence

CTTGGTCATTTAGAGGAAGTACAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTCGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCTGTGAACCCTGATGAAGATGGACTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGC