to top page


TOP > 2012-11-01 >Ascomycota >2000

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
20002012-11-01AscomycotaLecanicillium psalliotaeAB083034
98
3
305
-

Sequence

CTTGGTCATTTAGAGGAAGTACAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTTACAACTCCCAAACCCTTATGTGAACATACCATGATGTTGCTTCGGCGGACTCGCCCCGGCGTCCGGACGGCCTAGCGCCGCCCGCGGCCCGGATCCAGGCGGCCACCGGGAGACCACCAAAACTATTTTGTATCAGCAGTTTTTTTACTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG