to top page


TOP > 2012-11-01 >Ascomycota >1997

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
19972012-11-01AscomycotaConlarium duplumascosporaJN936996
94
1
278
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCCTTTGTTTATATACCTGTTCAGTTGCTTCGGTAGGCGGCCCCAGGGCGGGGCCTCCAGCCTGCTCACGCAGGTGCCTGCCGCTGGCGTAAAAACTCTTGTTATATATTATTATTCTGAGTCACAAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC