to top page


TOP > 2012-11-01 >Ascomycota >1996

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
19962012-11-01AscomycotaChloridium sp.HQ630978
99
1
273
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGGACTCGCAAGACTCCTACAACCCTGTGAACCTACTATACGAACGTTGCTTCGGCGGGTGCGCCCCGGGGATTCGTTCCCGCGGCGCGTCAGCCCGCCGGCAGCCCACAAATTCTGTTTCTTTGCGTTGGCATCTCGAGAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA