to top page


TOP > 2012-11-01 >Ascomycota >1995

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
19952012-11-01AscomycotaCercophora sp.HQ631039
92
3
253
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTATAGAGTTGCAAAACTCCCAACCCTTTGTGAACGAACTAGACAGTTGCCTCGGCGGGGCGCTCCTCAGGGAGCCGACCGCCGGAGGAATATAAACTCTTTATATTTTGTATCTCTGAGTACTTATTCAATAAGTTAAAACCTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG