to top page


TOP > 2012-11-01 >Ascomycota >1994

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
19942012-11-01AscomycotaCercophora coprophilaAY999136
96
1
265
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATCGTGAACCCACCCCTAAACAGTTGCTTCGGCGGCGCCCAGGGCCCCGCGCCCCAGGCCCGCCGGAGACCCCCAAACTCTTGTTTTTACACTGGCCTCTCTGAGTACTGTACTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA