to top page


TOP > 2012-08-01 >Unclassified >1897

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
18972012-08-01UnclassifiedUncultured fungusGU174418
99
43
231
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGAATGGCTTTGGCCTTCAACCTTCAAACCTGTGGAAGCTAAATGTGCTTCGGCGCCCTGGCGCCGCTTTTATGCTGTAATGTACTTGTGTCTGAATTTAANCAATGTTAAAAACTTTCAACAAAGGTATCTCTTAGGCTCTCGCATCGATAGAAGAACGCA