to top page


TOP > 2012-08-01 >Unclassified >1872

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
18722012-08-01UnclassifiedUncultured fungusGU187878
87
1
259
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTTGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACAAATCCAATATGTAGGTTTGGGGGTGAATAACCCTCTACCTAATATTAAACCGCTAGTCCGATTAATTAATTAATTAGTGGGACTAGTTGGATATATATGCATGTTATGTTGACAGTGTGTGTAATTAAAAATTTATTGACAACTTTTAACTAATGGATCTCTAGGCTCTTGCATCGATGAAGAACGCA