to top page


TOP > 2012-08-01 >Unclassified >1871

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
18712012-08-01UnclassifiedUncultured fungusJF927042
98
1
330
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACAAAGCTTGAAGTTCGCTCAACCGCGTTCTTCAACAAATCCATCCACACCTTGTGCAATATTGACATCGAGGCAAGTTCTTTCGGGAATTTGCTGGTCTTGTGGGGGGAAAAACCTAAAGGATAGGCAGCGATGCTTAACCTTTAAGCCCCCCAAAGTATTTAACCTATACGTTTTTTTTGGTTTGTCTGAAACTTTTTATTGATACAATAAAACAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGC