to top page


TOP > 2012-08-01 >Unclassified >1865

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
18652012-08-01UnclassifiedUncultured fungusJQ038325
86
4
255
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTTGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACAAATCCAATATGTGAGTTGGGGTGAATAACCTTGACCCAATATTAAACCGCTAGTCCGACTAATTAATTAATTAGTGGGACTAGTTGGATATATATGCATGTTATGTTGACAGTGTGTGTAATTAAAAATTTATTGACAACTTTTAACAATGGATCTCTAGGCTCTTGCATCGATGAAGAACGCA