to top page


TOP > 2012-08-01 >Ascomycota >1798

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17982012-08-01AscomycotaUncultured HelotialesFJ827180
99
2
271
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTCACGGGTAGATCTCCCACCCTTGAATATTATACCTTCGTTGCTTTGGCAGGCCGTGGAAACACCACGGGCTTCGGCTTGTGTGTGCCTGCCAGAGGAAACAAACTCTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACC