to top page


TOP > 2012-08-01 >Ascomycota >1792

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17922012-08-01AscomycotaUncultured AscomycotaAB636442
99
10
238
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACTGAATGGCCTTTTGGGCCTTCAACCTTCAAAAACATGTGGAAGCAAGATGTGCTTCGGTGCCTCTGGTGCCGCCTTTATGCAGTGAAGCCTTATTTGTCTGAACCAAAATCAAAAAGTTAAAACTTTCAACAAAGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA