to top page


TOP > 2012-08-01 >Ascomycota >1788

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17882012-08-01AscomycotaUncultured ascomyceteEU490123
98
139
265
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTCAGTCGATCTTCTTCATGGAGATCGACCAAACATCAACCTTATCTTTTTAAACTCTTTGTCTGAAAAAATATTATGAAATAAACAATTCAAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC