to top page


TOP > 2012-08-01 >Ascomycota >1786

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17862012-08-01AscomycotaTrichoderma sp.HQ647324
99
4
315
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC