to top page


TOP > 2012-08-01 >Ascomycota >1784

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17842012-08-01AscomycotaPenicillium sp.GU566284
99
1
290
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTGTACCTTGTTGCTTCGGCGGGCCCGCCTTTACGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGGAATTATGAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCA