to top page


TOP > 2012-08-01 >Ascomycota >1783

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17832012-08-01AscomycotaPaecilomyces javanicusAB099944
100
3
253
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTATCGAGTTTTCAACTCCCAAACCCTATGTGAACTTACCACACCGTTGCTTCGGCGCGCGCTCGCCGCCGCCGAGGACGTTAAACTCTGTCTTGTATAAGCATTTCTGAGTGGCCGCAAGGCAAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA