to top page


TOP > 2012-08-01 >Ascomycota >1781

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17812012-08-01AscomycotaOidiodendron truncatumGU062231
99
1
280
-

Sequence

CTTGTCATTTAGGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAGAGTTCTCGCCCTCACGGGTAGACCTCCCACCCACTGTGATTGTTACCGTCGTTGCTTTGGCGGGCCGCTGGGCCCAGCTCAGCCACCGGCCCCGGCTGGTGCGCGCCCGCCAGAGGCTCCGCAAACTCTTAATGTCAACGTCGTCTGAGTACTATATAATAGTTAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC