to top page


TOP > 2012-08-01 >Ascomycota >1775

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17752012-08-01AscomycotaDoratomyces columnarisFJ914707
98
5
289
-

Sequence

CTTGGTCATTTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAAGTTACCTTCAAAACCCGCTGTGAACCTTACCTCTTGCCGCGTTGTCTCGGCGGGAGGCGGTGTGCGTCGCGCGCCCTAGCGGGCCGTGCCGCTCCCGTCCCCGCCGGCAGCGCCAAACTCTAAATGCACAGCGGACTGTACGTTCTGATTTAACAAAAAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC