to top page


TOP > 2012-08-01 >Ascomycota >1773

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
17732012-08-01AscomycotaArthrinium sp.AJ279479
99
17
297
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTATACAACTCCCATACCATCTGTTAACCTACCCAGTTATGCCTCGGCGTAAGCTCGGTTGGAGGCACCTGCAGCTACCCCTGTAGTTGCGGACTTGCCAACTCCAGCCGCGGCCCGCCGGCGGTACACTAAACTCTGTTTTATTTTATATTCTGAGCGTCTTATTTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC