to top page


TOP > 2012-06-01 >Ascomycota >1596

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15962012-06-01AscomycotaUncultured yeastFJ808044
92
1
207
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGTGATTATAAATCTTATACACATGCGTGAGCGCAACAAACACATAAAAAACTGTAATACTTTTAGTCAACTAAGTTTTAAATAAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCA