to top page


TOP > 2012-06-01 >Ascomycota >1588

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15882012-06-01AscomycotaUncultured HelotialesJQ318662
99
10
275
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCGTGCCCTTCGGGGTAGACCTCCCACCCTTTGTATACCTACCTTTGTTGCTTTGGCGGGCCGTCGCAAGACCGGCGGCTTCGGCTGTCGTGTGCCCGCCAGAGGACCCCCAAACTCTGAATACAGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA