to top page


TOP > 2012-06-01 >Ascomycota >1580

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15802012-06-01AscomycotaUncultured AscomycotaHM162157
91
1
376
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACACGTATCCACGTATCAACCCCTCTGTGCAAACACATCTCTGAAAGGTTTGGTCTTAGTGCATGGTTCGCATGGGTCCTAATGATGGAGGCCAAGAAGCTTCGGCTTCTGGGCCTAGGGCTCGAACTGTGTGTGCTTGACGATCAACCGCCACTTTCCCATCGTTGGCCAACTTTTTTAACCCCTGTACTCTTTTGTACTGAACCAATTCTTCTGACGCTCTATTACTGAGTGACGGATAGATATTACGAAACTTAAGAACAACTCTTAGCAACGGATATCTTGGTTCCCGCATCGATGAAGAACGC