to top page


TOP > 2012-06-01 >Ascomycota >1579

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15792012-06-01AscomycotaUncultured AscomycotaFN562054
99
12
278
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAAAGAGTTGCAAAACTCCCAAACCATTGTGAACATACCTTCAACGTTGCTTCGGCGGGTTGGCCCCGGTCTCCGGGGTCCCCGGCCCTACTCGGGCGCCCGCCGGAGGTATCTAACTCTTGAACTTTTATGGCCTCTCTGAGTCTTTGTACTTAATAAGTCAAAACTTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA