to top page


TOP > 2012-06-01 >Ascomycota >1568

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15682012-06-01AscomycotaPodospora sp.GU166458
99
4
271
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAAAGAGTTGCAAAACTCCCTTAAACCATCGTGAACGTACCTCTGAACAGTTGCTTCGGCAGGCCGGCCCCCCCCGGGGGTGCCGCCAAAGGCCTGCCGAAGGTACCAAAACCATTGTTTTTACAGGCCTCTCTGAGTAACGTACTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA