to top page


TOP > 2012-06-01 >Ascomycota >1566

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15662012-06-01AscomycotaMyrothecium roridumHQ433334
99
1
278
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAGTCGTAACAAGGTCTCCGTTGGTGTACCAGCGGAGGGATCATTACCGAGTTTACAAACTCCCAAACCCTTTGTGAACCTTACCTATCGTTGCTTCGGCGGGACCGCCCCGGCGCCTTCGGGCCCGGAACCAGGCGCCCGCCGGAGGCCCCAAACTCTTATGTCTTTAGTGGTTTTCTCCTCTGAGTGACACATAAACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA