to top page


TOP > 2012-06-01 >Ascomycota >1565

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15652012-06-01AscomycotaIlyonectria coprosmaeJF735260
96
1
247
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCAAACCCCTGTGAACATACCATTTTGTTGCCTCGGCGGTGCCTGTTCCGACAGCCCGCCAGAGGACCCAAACCCTGTATTAAAGTATTCTTCTGAGTAAATGATTAAATCAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCA