to top page


TOP > 2012-06-01 >Ascomycota >1557

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
15572012-06-01AscomycotaCylindrocarpon pauciseptatumJF735307
99
5
255
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCAAACCCCTGTGAACATACCATTTTGTTGCCTCGGCGGTGCCTGTTCCGACAGCCCGCCAGAGGACCCCAAACCCAAACTTCCTTGAGTGAGTCTTCTGAGTAACCGATTAAAATCAATCAAAAACTTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA