to top page


TOP > November 2010 >Unclassified >1380

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1380November 2010Unclassified Uncultured fungusFJ777379
84
3
263
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGGATCATTACTGAGTTACTACTCTCAACCCTTTGTGAATTTACCTAGTGTTGCTTCGGCAGGTTTTCCCTGGGAGGGAAGTAGCCTTTGGGCAGCCTGCCAGAGGCATTTTAACTCTGATTTATTTTGAATTCTGAGTATAATACAAAAGAAAAAAACTTTCAGCAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA