to top page


TOP > November 2010 >Unclassified >1379

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1379November 2010UnclassifiedUncultured fungusJN905659
99
19
276
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTCGGGCTTCGGCCTAACCTCTTCAGCTGTGCGCTTCGGCTGCACGCTGTCGAAACCTCTCACACCTGTGCACCTTTTCGGTTTGCGGCGTTCGCGTCGCTTCCGCTTTACACATTTTACTACAAAAGTCCAGAATGTCAAAACTATAAACATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC