to top page


TOP > November 2010 >Unclassified >1377

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1377November 2010UnclassifiedUncultured soil fungusDQ980581
100
2
272
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTACTCCAAACCCTTTGTGAACCTTACCTATGTTCTGTTGCCTCGGCGGGGAGGAAGACCCCTTAAAAAGGGCCCAGCCCCCGCCGGCAGCACCAAACTCTTGCATTTATAGCGGATTACATTTCTGAATACAATACAAAACAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA