to top page


TOP > November 2010 >Unclassified >1376

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1376November 2010UnclassifiedUncultured fungus cloneFJ781970
86
1
220
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGATTTTTGTCGAGCCTGGCTCGCGAAAAAATTCTGTATTTAAAACACCCACCCTTTTTTAAAAAATGTTATTAAAATTTTAATTATTTGAAATAATTAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA