to top page


TOP > November 2010 >Unclassified >1375

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1375November 2010UnclassifiedUncultured endophytic fungusFJ524302
85
1
266
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCAAACCATTGTGGACTAGCCTGACAGGTGCTTCGGAAGGCCGGGTGAGGTGTGAAAACGCCGCTCTTGCGCCTACCGAAGTCATCAAAACTCTTATTTATTGTGGCATCTCTGAGTAACTTTTAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA