to top page


TOP > November 2010 >Unclassified >1374

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1374November 2010UnclassifiedUncultured soil fungusDQ420925
100
1
347
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTAGAGCAAAGGATAGACAGCGCCCGCGGAGCTCGCTCCCGGGGCTACCCTACTCCCGTAGGGTTTAGAGTCGTCGGGCCTCTCGGAGAAGCTCGGTCCTGAACTCCACCCTTGAATAAACTACCTTTGTTGCTTTGGCGGGCCGCCTCGTGCCAGCGGCTTCGGCTGTTGAGTGCCCGCCAGAGGACCCCAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC