to top page


TOP > November 2010 >Unclassified >1373

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1373November 2010UnclassifiedUncultured ectomycorrhizaAY825519
95
2
289
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTCATTTGAATCGTTACCTTCAGTGCTGGCTGGTCCTCCGGCAAGTGCACGTTGGTGACTTTCATCCATACCCCTGTGCACCTTTGGCCTCTTGCTGGCTTCGGCTGACAGAGGATTTTACACCCACTCGAATGTAATGAAAACTACTGTTGTGCGCAAGCACTACCGAATGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC