to top page


TOP > November 2010 >Unclassified >1372

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1372November 2010UnclassifiedUncultured ectomycorrhizal fungusAB669503
98
70
295
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAAGTCGTAAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAATTATGAGCGAGGGTTGTCGCTGGTCCCCTCGGGGGCATGTGCACGCCTGAGCTCTTAAATCCCACCACACACCTGTGAACCCACCGTGGGCCCTGCAAGGGGCTCGCCTCTATATACTCTAGCATGTCTCATAGAATGTCAAATTGTTTGCCTTAAAAACGCAATCAAATACAACTTTCAACGAACGGATCTACTTGGCTCTCGCATCGATGAAGAACGC