to top page


TOP > November 2010 >Unclassified >1371

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1371November 2010UnclassifiedUncultured soil fungusJX560485
99
40
263
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTCAGTCGATCTTCTTCATGGAGATCGACCAAACATCAACCTCTATTTTTTAACTCTTTGTCTAGAAAAATATTATGAATAAACAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA