to top page


TOP > November 2010 >Unclassified >1370

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1370November 2010UnclassifiedUncultured fungusHM030580
96
2
289
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCTACTCCCAAACCCCTGTGAACTTATACCTTTACTGTTGCTTCGGCGGGTTAACGCCCCGGAACGGCCCCCCAAGGCCTCCCGGAACCAGGCGCCCGCCGGGGGACCCAAACTCTTGTATTTCTTACTTTGCATGTCTGAGTGGAATCATAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA