to top page


TOP > November 2010 >Unclassified >1368

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1368November 2010UnclassifiedUncultured soil fungusHE977550
96
2
256
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACTGAGACTTATCTCATAACCCTTTGTGAACCTTTATAACCTGTTGCTTCGGCGGCGCGGCCCCCGGGTCGTGCCCGCCGGTATCATCAGAATCTCTGTTCGAACCCGACGATACTTCTGAGTGTTCTAAGCGAACTGTTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCA