to top page


TOP > November 2010 >Unclassified >1367

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1367November 2010UnclassifiedUncultured soil fungusEU826893
97
1
269
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTTAAATCCATATCCACCTTGTGTGCAATGTCAGGGTTGGTCTCTCTCTTTTGAGAGATCAGCCCCAAACATCAACCTACATTTCAACTCTTTGTCTGAAAAATATTATGAATAAAACAATTACAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC