to top page


TOP > November 2010 >Unclassified >1366

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1366November 2010UnclassifiedUncultured fungusJQ038325
89
1
242
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTTGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACAAATCCAATAGTTGTGTTGTAGGGGCGACCCTACTCGCAAATATTAAACCGCCGGTTATTCGTAACTGGCTGGTAGATATAAATGCATGTTGTGTTGACAGTGTGTGTGACTAAAATTTATTGACAACTTTTAACAATGGATCTCTAGGCTCTTGCATCGATGAAGAACGCA