to top page


TOP > November 2010 >Unclassified >1363

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1363November 2010UnclassifiedUncultured soil fungusJQ666694
97
7
272
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTACGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAAATGAGTGTTTTATGGCACTCTTTAAAAATCCATATCCACCTTGTGTGCAATGTTTGTTGGGAAAGCTTCTTGCTTTCCCTTCATAATATCAACCTATATCTTTAACAACATTCGTCTGATAACATATTATGAATATACTTAATTCAAAATATAACTTTCAACAACGGATACTCTTGGCTCTCGCATCGATGAAGAACGC