to top page


TOP > November 2010 >Unclassified >1362

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1362November 2010UnclassifiedUncultured fungusGQ523319
98
3
266
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTACGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCCTGCCGTTTCGACGGCGAGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTTAAGTAAATTTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA