to top page


TOP > November 2010 >Unclassified >1360

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1360November 2010UnclassifiedUncultured fungusFJ781035
86
1
289
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTGCAAAACTCCCTAAACCCATCGTTTATTTATCTTAGAAAAGCGTCTGCTTCGGCGGGCGGCCCCAGGGCGGGCCGCGGCCGTGCCTGTGGTACGGCGCCCGCCGAAGAAGACGAAGCCCAAACTCTTGTATTTCAGTACCACTCTGAGCCTAAAGACAAATAATACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC