to top page


TOP > November 2010 >Unclassified >1357

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1357November 2010UnclassifiedUncultured fungusJN905472
80
1
326
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTGAAGTGGGTCTTTGAGCTGGCTTTTCACGAAGCACCGTGCTCGGGCCCCGCTCCATCCACTCAACCCCTGTGCACTTTCGATGGCGTGGTCTCGTTGAGTGATGTTCCATTCATTTGGACATCGGAGGTCGCGACGTCGTCTTATCACAAACTTATTACAATAGTCTTGTCGAACGTGGATGCTCGTAAGGGCGGAAACACAATACAACTTTCAACAACGGATCTCTTGGTTCTGGCACGATGAAGAACGC