to top page


TOP > November 2010 >Unclassified >1355

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1355November 2010UnclassifiedUncultured fungusFN610971
99
252
275
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTACGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACAAACGAGTGTTTTATGGCACTCTTTAAAAATCCATATCCACCTTGTGTGCAATGTTTGTTGGGAAAGTCTTTTCTTTCCCCTTCATAAATATCAACCTATATCTTTAACAACATTCGTCTGATAACATATTATGAATATACTTAATTCAAAATATAACTTTCAACAACGGATACTCTTGGACTCTCGCATCGATGAAGAACGCA